Learn more Webcast featuring eSpOT-ON
Explore More eSpOT-ON Nuclease Protein Available Now
Explore More Order eSpOT-ON Nuclease mRNA Now
PRODUCT

hfCas12max Recombinant Protein

High-fidelity Cas12 nuclease protein for therapeutic gene editing

hfCas12Max is a high-fidelity CRISPR nuclease engineered for therapeutic genome editing. It offers high on-target and low off-target editing across various cell types. Its small size and broad PAM sequence recognition make it an ideal choice for both ex vivo and in vivo CRISPR-based therapeutic development, allowing you to edit more of the genome with confidence.

  • Engineered for high-fidelity with high on-target and low off-target editing
  • Broad PAM sequence recognition expands the range of editable genomic sites
  • Small size allows for efficient delivery using AAV and lipid nanoparticles
  • Requires a shorter sgRNA, enhancing stability and editing efficiency

Select a Size

hfCas12max Recombinant Protein (100 µg)

#R20HFCAS12MAXHC-Sm
Description

About hfCas12Max CRISPR Nuclease

hfCas12Max nuclease is an engineered, high-fidelity Cas12i nuclease that offers a proven foundation for therapeutic development. Its broad PAM recognition, high specificity, and compact size enable efficient editing across a wide range of cell types and delivery modalities, including LNPs and AAVs.

hfCas12Max delivers consistently strong on-target activity with minimal off-target editing, making it a safer nuclease alternative for developing ex vivo or in vivo therapies. Its broad PAM profile expands access to genomic regions that are inaccessible to traditional nucleases, while its small size (1080 aa) supports simplified formulation and packaging for therapeutic delivery. With performance across various cell types, including primary T cells and iPSCs, hfCas12Max is positioned to accelerate the development of innovative CRISPR-based therapies.

Image
RNP complex schematic of hfCas12Max. Depicted in the schematic are genomic DNA (light blue), PAM sequence (pink), and predicted cut site locations on genomic DNA (gray scissors). Nuclease is depicted in light green/blue gradient color. The guide RNA or gRNA is comprised of the target sequence (green) and scaffold (dark blue).

Key Features

High Fidelity:
Minimal off-target editing with strong on-target efficiency for safer therapeutic development.

Broad PAM Recognition:
Broad PAM compatibility supports expanded genomic targeting.

Compact Nuclease Size:
At 1080 amino acids, hfCas12Max is optimized for delivery via LNPs and AAVs.

Performance Across Cell Types:
Efficiency in primary T cells, iPSCs, and other key therapeutic cell populations.

Engineered for Therapeutic Use:
Designed to support both ex vivo and in vivo genome-editing workflows.

Deliverables

Product Number R20HFCAS12MAX
Concentration 10 mg/mL
2.93 mg/mL
Volume 10 µL
50 µL
100 µL
500 µL
Intended Use This product is intended for research use only
Shipping Conditions Cold Pack
Buffer Composition 30mM Tris, 350mM NaCl, 50% Glycerol, 0.1mM EDTA, 1mM DTT, pH 8.0
Source E. coli
Purity ≥ 95%
Delivery Format Tubes
Function Enables high-fidelity gene editing with an expanded targeting range through direct delivery of a ribonucleoprotein (RNP) complex.
For Use In CRISPR gene editing experiments utilizing the hfCas12Max recombinant protein nuclease
Storage Temperature -20°C

Specifications

Specification hfCas12Max
Size 1080 amino acids
PAM Sequence (N = any nucleotide) 5'-TN-3' or 5'-TTN-3'
DNA Cleavage Staggered-cut: cleavage on the target strand occurs 24 nt downstream from the PAM, while the non-targeted strand is cut 14-16 nt downstream
Endonuclease Domains RuvC
gRNA Length 44 - 50 nt (crRNA only, no tracrRNA)
Target Sequence Length 20 nt
Enzyme Class Type V CRISPR-Cas system of Cas12
guide rna

Designing hfCas12Max gRNA

For CRISPR gene editing, hfCas12Max nuclease is unique in that it requires only a crRNA, eliminating the need for a tracrRNA. Its gRNA is compact, 44–50 nt in length, with a 17–23 nt target genomic sequence. When complexed with our Research gRNA, hfCas12Max’s single RuVC domain nicks the non-target strand and creates a staggered cut on the target strand, with cleavage predicted 14–16 nt and 24 nt downstream of the PAM site for the non-targeted and targeted strands, respectively.

To design hfCas12Max gRNA, upload the 5'-TN-3' or 5'-TTN-3' PAM sequence into your favorite guide design platform. Once designed, we can quickly synthesize your hfCas12Max gRNA, including chemical modifications that enhance editing efficiency, so you can begin experiments without delay.

Try hfCas12Max nuclease and gRNA in your workflow with our validated* gRNAs below.
Gene Name hfCas12Max Target Sequence
B2M TATCTCTTGTACTACACTGA
TRAC GAGTCTCTCAGCTGGTACAC
*Validated in human cell lines (HEK293T, T Cells, and iPSC). hfCas12Max gRNAs are not compatible with SpCas9. SpCas9 sgRNA controls can be purchased here.

The following modifications are included on our hfCas12Max modified gRNA:

2'-O-Methyl analog at the first 3 bases. The last 4 bases have 3 modifications ending with a nonmodified base. With 3' phosphorothioate bonds between 3 first and last 4 bases.

Data

Effective Editing Across Diverse Cell Types

Maintaining editing efficiency without sacrificing viability is especially challenging in difficult cell types like primary T cells. hfCas12Max nuclease demonstrates high editing with preserved viability across multiple therapeutically relevant cell types.

Image
Examining hfCas12Max’s nuclease editing efficiency across multiple cell types, specifically targeting the TRAC gene. The results demonstrated that hfCas12Max achieved an average editing efficiency of 60% across various cell types.

High Viability for Downstream Assays

Image
Knockout of TRAC in primary T cells was done using hfCas12Max nuclease. Analysis of editing efficiency was analyzed by Sanger sequencing.

Multi-Gene Knocks Out with hfCas12Max

Image
Using hfCas12Max Nuclease, a single knockout of TRAC (A) and a double knockout of B2M and TRAC (B) was achieved in primary T cells. Editing efficiency was evaluated using Sanger sequencing, while TRAC protein expression was analyzed through flow cytometry.

Minimize Off-Target Editing

Nucleases with low target specificity can cause unwanted edits. hfCas12Max delivers high on-target efficiency with minimal off-target activity, supporting safer and more reliable therapeutic development.

Image
On-target (ON) and off-target (OF) analysis comparison of hfCas12Max, UltraAsCas12a, and LbCas12a targeting P2RX5 loci (A) and CLIC4 loci (B). NGS verification of in silico off-target sites. hfCas12Max demonstrates minimal off targets when compared to other Cas12 nucleases.

Check out the science behind how hfCas12Max nuclease was engineered for therapeutic application.

The publication highlights the development of hfCas12Max nuclease, an engineered high-fidelity variant of the Cas12i system, optimized for therapeutic application. Engineered using a unique platform, hfCas12Max nuclease achieved superior editing efficiency, has a broad PAM sequence recognition profile, and demonstrated a significant reduction of off-target effects. These achievements make hfCas12Max nuclease particularly well-suited for therapeutic applications, as demonstrated through its effective use in ex vivo T-cell editing and in vivo delivery gene editing showcasing its potential to address genetic disorders and drive CRISPR-based therapies.

Image
Off-target analysis comparison between hfCas12Max (A) and SpCas9 (B).Verified via NGS with additional analysis conducted in silico and with PEM-seq off-target analysis.

Expand Access to More Genomic Targets

Strict PAM requirements can limit where edits are possible, making it difficult to target your region of interest. hfCas12Max features a broad PAM recognition profile, enabling editing across a wider range of genomic sites, including AT-rich regions.

Image
Comparative analysis of PAM sequence recognition between hfCas12Max nuclease and other common Cas nucleases reveals that hfCas12Max nuclease exhibits an expanded PAM recognition profile.
FAQ

Answers to Commonly Asked hfCas12Max Questions

If you have additional questions please connect with a member of our team.

How does hfCas12Max differ from standard Cas12a or SpCas9?
hfCas12Max is a Cas12i variant and offers unique advantages for genome editing. It provides a broader PAM compatibility range than Cas12a and demonstrates higher specificity than many SpCas9 variants. Researchers often select hfCas12Max when they want to balance editing efficiency with high-fidelity performance, particularly in applications where minimizing off-target effects is critical.

What type of DNA cut does hfCas12Max produce and how does it influence repair outcomes?
hfCas12Max makes a staggered (sticky-end) cut: target strand ~24 nt downstream of PAM, non-target strand ~14–16 nt downstream. This can influence indel patterns and HDR outcomes compared with blunt-end nucleases.

Synthego provides more than one PAM recommendation is provided; which one is best?
hfCas12Max supports multiple PAM sequences (5’-TN-3’ and 5’-TTN-3’). For most applications, the choice depends on your target site availability and desired editing efficiency. Guides using either PAM can work effectively, but TTN PAMs tend to be associated with higher editing efficiency.

Ready to get started?

Get in touch